O que é sulforafano? | El Paso, TX Médico da Quiropraxia
Dr. Alex Jimenez, Chiropractor de El Paso
Espero que você tenha gostado de nossas postagens de blog em vários tópicos relacionados à saúde, nutrição e lesões. Por favor, não hesite em chamar-nos ou eu mesmo, se tiver dúvidas sobre a necessidade de procurar cuidados. Ligue para o escritório ou para mim. Office 915-850-0900 - Celular 915-540-8444 Agradáveis. Dr. J

Sulforaphane é um fitoquímico, uma substância dentro do grupo isotiocianato de compostos organosulfurados, encontrado em vegetais crucíferos, como brócolis, repolho, couve-flor e couve de Bruxelas. Ele também pode ser encontrado em bok choy, couve, couve, mostarda e agrião. Estudos de pesquisa mostraram que o sulforafano pode ajudar a prevenir vários tipos de câncer ativando a produção de Nrf2ou fator nuclear eritroide 2-related factor, um fator de transcrição que regula os mecanismos antioxidantes protetores que controlam a resposta da célula aos oxidantes. O objetivo do artigo a seguir é descrever a função do sulforafano.

Abstrato

O sistema antioxidante KEAP1-Nrf2-ARE é o principal meio pelo qual as células respondem a estresses oxidativos e xenobióticos. O sulforafano (SFN), um isotiocianato eletrofílico derivado de vegetais crucíferos, ativa a via KEAP1-Nrf2-ARE e tornou-se uma molécula de interesse no tratamento de doenças nas quais o estresse oxidativo crônico desempenha um papel etiológico importante. Nós demonstramos aqui que as mitocôndrias de células epiteliais de pigmento da retina (RPE-1) humanas cultivadas tratadas com SFN sofrem hiperfusão que é independente tanto de Nrf2 quanto de seu inibidor citoplasmático KEAP1. Foi relatado que a fusão mitocondrial é citoprotetora ao inibir a formação de poros nas mitocôndrias durante a apoptose e, consistente com isso, mostramos a citoproteção independente de Nrf2 de células tratadas com SFN expostas ao apoptose-indutor, estaurosporina. Mecanisticamente, o SFN atenua o recrutamento e / ou a retenção do fator de fissão solúvel Drp1 às mitocôndrias e aos peroxissomas, mas não afeta a abundância geral do Drp1. Estes dados demonstram que as propriedades benéficas do SFN se estendem além da ativação do sistema KEAP1-Nrf2-ARE e garantem uma interrogação adicional, dado o uso atual deste agente em múltiplos ensaios clínicos.

Palavras-chave: Sulforafano, Nrf2, Drp1, Mitocôndria, Fissão, Fusão, Apoptose

Introdução

Sulforafano é um inibidor independente da fissão mitocondrial Nrf2

Sulforafano (SFN) é um composto de isotiocianato derivado na dieta mais comumente de vegetais crucíferos [56]. É gerado em plantas como uma resposta xenobiótica à predação via liberação vesicular da enzima hidrolítica mirosinase de células danificadas; esta enzima converte glucosinolatos em isotiociantes [42]. Nas duas últimas décadas, a SFN tem sido amplamente caracterizada por suas propriedades antineoplásicas, antioxidantes e antimicrobianas [57]. Grande parte dessa eficácia tem sido atribuída à capacidade do SFN modular a via de sinalização do elemento de resposta antioxidante KEAP1-Nrf2 (ARE), embora atividades adicionais do composto tenham sido identificadas, incluindo a inibição da atividade da histona deacetilase e da progressão do ciclo celular. 29]. Nrf2 é o principal fator de transcrição antioxidante e, sob condições de homeostase, sua estabilidade é suprimida através da ação do complexo citoplasmático de ubiquitina ligase Cullin3KEAP1 [20]. Especificamente, o Nrf2 recrutado para a ligase Cullin3KEAP1 por ligao ao adaptador de substrato dimico KEAP1 e subsequentemente modificado com cadeias poliUb que visam o factor de transcrio para a degradao mediada por proteassoma. Este volume de negócios constitutivo limita a meia-vida do Nrf2 em células não-tensionadas para ~ 15 min [30], [33], [46], [55]. Em resposta a numerosos tipos de estresse, principalmente o estresse oxidativo, KEAP1, uma proteína rica em cisteína, atua como um sensor redox, e a modificação oxidativa de cisteínas críticas, particularmente C151, de KEAP1 dissocia NRF2-KEAP1 de CUL3, prevenindo a degradação de Nrf2. 8], [20], [55]. Notavelmente, o SFN, e possivelmente outros ativadores Nrf2, mimetizam o estresse oxidativo modificando o C151 de KEAP1, por exemplo, [21]. A estabilização do Nrf2 permite a sua translocação para o núcleo, onde induz a expressão de uma bateria de genes antioxidantes e de desintoxicação da Fase II. O Nrf2 liga-se aos elementos promotores da resposta antioxidante (ARE) dos seus genes alvo cognatos através da heterodimerização com pequenas proteínas Maf [19]. Este sistema apresenta uma resposta dinâmica e sensível a antioxidantes indiretos como o SFN, os radicais livres gerados pelas mitocôndrias [16] ou outras fontes fisiológicas de estresse oxidativo [41].

As mitocôndrias são organelas subcelulares dinâmicas que regulam uma série de funções celulares que vão desde a produção de ATP e tamponamento de cálcio intracelular até a regulação redox e apoptose [13], [49]. As mitocôndrias também representam a principal fonte de espécies reativas de oxigênio (EROs) dentro da célula. A regulação adequada da função mitocondrial é, portanto, necessária para otimizar a produção de ATP para atender às necessidades celulares e, ao mesmo tempo, minimizar os efeitos potencialmente prejudiciais da produção excessiva de radicais livres. Um requisito crítico para a modulação fina da função mitocondrial é a capacidade de as mitocôndrias funcionarem independentemente como máquinas bioquímicas e como parte de uma vasta rede responsiva.

A morfologia e a função da rede mitocondrial são determinadas por um balanço regulado entre a fissão e a fusão. A fissão mitocondrial é necessária para a herança de células filhas de mitocôndrias durante a divisão celular [28], bem como para a degradação seletiva e autofágica de mitocôndrias despolarizadas ou danificadas, denominada mitofagia [1]. Por outro lado, a fusão é necessária para a complementação de genomas mitocondriais e compartilhamento de componentes da cadeia de transporte de elétrons entre as mitocôndrias vizinhas [54]. No nível molecular, a fissão e a fusão mitocondrial são reguladas por grandes GTPases do tipo dinamínico. Três enzimas regulam principalmente a fusão: Mitofusinas 1 e 2 (Mfn1 / 2) são proteínas de membrana externa de duas passagens que medeiam a fusão da membrana externa via interações heterotípicas entre mitocôndrias adjacentes [15], [25], [37], enquanto OPA1 é uma proteína de membrana que garante simultaneamente a conectividade da matriz, regulando a fusão das membranas internas [5]. A atividade GTPase de todas as três proteínas é necessária para a fusão robusta [5], [18] e OPA1 é ainda regulada por proteólise complexa dentro da membrana interna mitocondrial pelas proteases OMA1 [14], PARL [6] e YME1L [45 ]. É importante ressaltar que o potencial de membrana mitocondrial intacta é necessário para a fusão eficiente, a fim de suprimir a integração de mitocôndrias danificadas e saudáveis ​​[26].

A fissão mitocondrial é principalmente catalisada por uma proteína citosólica chamada proteína relacionada à Dynamin 1 (Drp1 / DNM1L). O Drp1 é recrutado do citosol para sítios prospectivos de fissão na membrana externa mitocondrial [43]. Os principais receptores para Drp1 na membrana externa são o fator de fissão mitocondrial (Mff) [32] e, em menor extensão, a Fissão 1 (Fis1) [51]. Adicionalmente, foi descoberto um receptor chamariz, MIEF1 / MiD51, que atua para limitar ainda mais a atividade da proteína Drp1 em potenciais locais de fissão [58]. Uma vez ancorados na membrana externa mitocondrial, o Drp1 se oligomeriza em estruturas em espiral ao redor do corpo da mitocôndria e, em seguida, utiliza a energia derivada da hidrólise do GTP para mediar a cisão física das membranas externa e interna mitocondrial [17]. Túbulos derivados do retículo endoplasmático atuam como um constritor inicial de mitocôndrias antes da oligomerização Drp1, ressaltando a revelação de que as mitocôndrias não constritas são mais largas que a circunferência permissiva de uma espiral Drp1 completa [12]. A dinâmica da actina também é importante para as interações ER-mitocôndrias que precedem a fissão mitocondrial [24]. Além de seu papel na fissão mitocondrial, o Drp1 catalisa a fissão de peroxissomas [40].

O Drp1 é muito semelhante à proteína dinamina bem caracterizada pelo fato de que ambas as proteínas contêm um domínio GTPase N-terminal, um domínio Médio que é crítico para auto-oligomerização e um domínio efetor GTPase C-terminal [31]. Drp1 alcança seletividade para membranas mitocondriais através de uma combinação de interações com suas proteínas receptoras Mff e Fis1 e também através de sua afinidade pela cardiolipina fosfolipídica específica das mitocôndrias via o domínio único de inserção B de Drp1 [2]. Drp1 normalmente existe como um homotetrâmero no citoplasma, e montagem de ordem superior nos locais de fissão mitocondrial é mediada pelo domínio do meio de Drp1 [3].

Dada a ligação implícita entre a função mitocondrial e a via KEAP1-Nrf2-ARE, investigamos os efeitos da ativação de Nrf2 na estrutura e função mitocondrial. Nós demonstramos aqui que o SFN induz a hiperfusão mitocondrial que, inesperadamente, é independente tanto de Nrf2 quanto de KEAP1. Este efeito do SFN é através de uma inibição da função Drp1. Demonstramos ainda que SFN confere resistência à apoptose que é independente de Nrf2 e mimetiza aquela observada em células depletadas de Drp1. Esses dados coletivamente indicam que, além de estabilizar e ativar o Nrf2, o SFN modula a dinâmica mitocondrial e preserva a aptidão e a sobrevivência celular.

Resultados

O sulforafano induz a hiperfusão independente de Nrf2 / KEAP1 de Mitocondria

No decorrer do estudo dos efeitos da ativação Nrf2 na dinâmica da rede mitocondrial, descobrimos que o tratamento de células epiteliais de pigmento retiniano (RPE-1) imortalizadas com sulforafano (SFN), um potente ativador da sinalização Nrf2, induziu uma fusão robusta de a rede mitocondrial quando comparada com células de controlo tratadas com veículo (Fig. 1A e B). A morfologia das mitocôndrias nessas células se assemelhava muito à mitocôndria das células depletadas pelo siRNA do Drp1 endógeno, o principal fator de fissão mitocondrial (Fig. 1A). Este resultado levantou a idéia intrigante de que a fissão mitocondrial e o status de fusão respondem diretamente aos níveis de Nrf2 na célula. No entanto, a estimulação de células com outros estabilizadores e ativadores Nrf2, tais como o inibidor de proteassoma MG132, o pro-oxidante tBHQ, ou o knockdown do inibidor de Nrf2 KEAP1, não induziu a fusão mitocondrial (Fig. 1A e B). A estabilização de Nrf2 por estas manipulações foi confirmada por Western blotting para Nrf2 endógena (Fig. 1C). Além disso, a expressão de Nrf2 foi dispensável para a fusão mitocondrial induzida por SFN, uma vez que o silenciamento de Nrf2 endógeno com siRNA falhou em contrariar este fenótipo (Fig. 1D-F). Como o SFN estimula a via KEAP1-Nrf2-ARE pela modificação covalente dos resíduos de cisteína de KEAP1 [21], derrubamos o KEAP1 para avaliar se a hiperfusão mitocondrial induzida por SFN é estimulada por uma via independente de KEAP1, mas independente de Nrf2. No entanto, a depleção de KEAP1 também não anulou a fusão mitocondrial induzida pelo SFN (Fig. 1G-I). De fato, o SFN reverteu a morfologia pró-fissão induzida pela depleção de KEAP1 (Fig. 1G, painel b versus painel d). Esses resultados indicam que o tratamento com SFN causa a fusão mitocondrial independente da via canônica KEYNGXX-Nrf1-ARE e nos levou a questionar se o SFN afeta diretamente os componentes da fissão mitocondrial ou do maquinário de fusão.

Figura 1 SFN induz a fusão mitocondrial independente de Nrf2 / KEAP1. (A) As células RPE-1 foram transfectadas com os siRNAs indicados e 3 dias depois foram tratados com DMSO ou os activadores Nrf2 SFN (50 μM), MG132 (10 μM) ou tBHQ (100 μM) para 4 h. As mitocôndrias (vermelho) são marcadas com um anticorpo anti-Tom20 e os núcleos (azul) são contra-corados com DAPI. (B) Gráfico mostrando a quantificação da pontuação da morfologia mitocondrial de (A). > Células 50 por condição foram avaliadas de forma cega. (C) Western blots representativos de (A). (D) As células RPE-1 foram transfectadas com siNNA 10 nM e 3 dias depois foram tratadas com SFN para 4 h antes de serem fixadas e coradas como em (A). (E) Gráfico mostrando a quantificação da pontuação do fenótipo mitocondrial de (D). > Células 100 por condição foram avaliadas de forma cega. (F) Western blots representativos de (D). (G) Células foram transfectadas e tratadas como em (D) com siCON ou siKEAP1. (H) As células de (G) foram pontuadas como em (B) e (E) com base na morfologia mitocondrial. (I) Westerns representativos de (G). Os dados em (B), (E) e (H) foram compilados a partir de expericias independentes de 3 cada e a significcia estattica foi determinada pelo teste t de Student bicaudal. Barras de erro refletem +/- SD (para interpretação das referências a cor nesta legenda de figura, o leitor é referido à versão web deste artigo).

Sulforafano prejudica a associação mitocondrial de Drp1

Com base na constatação de que o tratamento com SFN induz a hiperfusão mitocondrial, raciocinamos que esse fenótipo era uma consequência da atividade excessiva de fusão ou uma inibição da atividade da fissão. Para discriminar entre essas duas possibilidades, comparamos a morfologia dos peroxissomas na presença e ausência de SFN. Os peroxissomos são semelhantes às mitocôndrias, pois são organelas dinâmicas cuja forma e comprimento estão constantemente em fluxo [44]. Os peroxissomos contêm tanto Fis1 quanto Mff em sua membrana externa e, como conseqüência, são alvos para a fissão mediada por Drp1 [22], [23]. No entanto, os peroxissomos não utilizam a maquinaria de fusão da rede mitocondrial e, consequentemente, não são submetidos à fusão [39]. Pelo contrário, a fissão peroxisomal é oposta pelo aumento dos peroxissomos existentes através da adição de novo de membranas e proteínas [44]. Como os peroxissomas carecem de Mfn1 / 2 e OPA1, concluímos que se o SFN ativasse a maquinaria de fusão em vez de inibir a maquinaria de fissão, o comprimento do peroxissoma não seria afetado. Nas células tratadas com veículo, os peroxissomos são mantidos como organelas puntiformes curtas e arredondadas (Fig. 2, painéis b e d). Entretanto, o tratamento com SFN aumentou o comprimento do peroxissoma em ~ 2 vezes em comparação com as células controle (Fig. 2, painéis f e h). Além disso, muitos dos peroxissomos estavam comprimidos perto do centro, indicando um potencial defeito de cisão (Fig. 2, painel h, cabeças de setas). Da mesma forma, os peroxissomas em células transfectadas com siRNA Drp1 eram anormalmente longos (Fig. 2, painéis j e l), confirmando que Drp1 é necessário para fissão peroxisomal e sugerindo que o tratamento com SFN causa fenótipos mitocondriais e peroxissômicos ao interromper a maquinaria de fissão.

Figura 2 SFN induz alongamento peroxisomal. (A) As células RPE-1 foram transfectadas com 10 nM do siRNA indicado e 3 dias depois foram tratadas com DMSO ou 50 μM SFN para 4 h. Os peroxissomos (verde) foram marcados com um anticorpo anti-PMP70, mitocôndrias com MitoTracker (vermelho) e DNA contrastado com DAPI. Inserções aumentadas de peroxissomas são mostradas à direita (painéis d, he el) para facilitar a visualização das mudanças na morfologia induzidas pela depleção de SFN e Drp1. Pontas de seta destacam pontos de constrição. (Para interpretação das referências a cor nesta legenda da figura, o leitor é encaminhado para a versão web deste artigo).

Em seguida, determinamos como o SFN restringe a função Drp1. As possibilidades incluíram reduções nos níveis de expressão, recrutamento / retenção na mitocôndria, oligomerização ou atividade enzimática da GTPase. Um déficit em qualquer um deles resultaria em redução da fissão e hiperfusão mitocondrial. Não detectamos alterações reprodutíveis nos níveis de proteína Drp1 após tratamento com SFN (Figs. 1C e 3A), e, portanto, concluiu que SFN não altera a estabilidade ou expressão de Drp1, consistente com Drp1 tendo uma meia-vida de> 10 h [50] e nossos tratamentos de SFN sendo de menor duração. Em seguida, investigamos se o SFN afetou o recrutamento ou retenção de Drp1 às mitocôndrias. Estudos de fracionamento mostraram que o SFN induziu uma perda de Drp1 da fração mitocondrial (Fig. 3A, pistas 7-8 e Fig. 3B). Conforme relatado anteriormente [43], apenas uma fração menor de Drp1 (~ 3%) está associada à rede mitocondrial em qualquer momento durante curso estável condições com a maior parte da enzima residente no citoplasma (Fig. 3A, pistas 5-8). Estes dados de fraccionamento foram confirmados utilizando anise de co-localizao que mostrou uma reduo de ~ 40% em focos Drp1 punctados localizados na mitocdria ap tratamento com SFN (Fig. 3C e D). Juntos, esses dados indicam que a fusão mitocondrial induzida por SFN é, pelo menos parcialmente, devido à associação atenuada de Drp1 com a mitocôndria. Nossos dados não distinguem entre se o SFN interfere no recrutamento mitocondrial versus a retenção mitocondrial do Drp1, ou ambos, já que a análise do Drp1 endógeno não foi capaz de visualizar a GTPase pela microscopia de células vivas.

Figura 3 SFN causa uma perda de Drp1 da mitocôndria. (A) Fraccionamento subcelular de células RPE-1 após 4 h de DMSO ou SFN. As fracções de lisados ​​de célula total (WCL), nuclear (Nuc), citosólica (Cyto) e mitocondrial (Mito) bruta foram resolvidas por SDS-PAGE e processadas para Western blotting com os anticorpos indicados. A migração dos marcadores de peso molecular é indicada à esquerda. (B) Gráficos mostrando quantificação densitométrica de Drp1 nas frações indicadas de (A). (C) RPE-1 células foram transfectadas com 10 nM siCON ou siDrp1 e 3 dias depois tratados com DMSO ou SFN para 4 h. Drp1 (verde) foi visualizado com um anticorpo anti-Drp1, mitocôndrias com MitoTracker (vermelho) e núcleos com DAPI (azul). (D) Análise de co-localização automatizada do sinal Drp1 e MitoTracker de (C). Os dados em (B) e (D) foram compilados a partir de experiências independentes com 3 e 5, respectivamente, e a significância estatística foi determinada pelo teste t de Student bicaudal. Barras de erro refletem +/- SD e asteriscos denotam significância estatística. (Para interpretação das referências a cor nesta legenda da figura, o leitor é encaminhado para a versão web deste artigo).

Sulforafano confere proteção contra apoptose induzida por estaurosporina independente de Nrf2

Trabalhos anteriores mostraram que a fissão mitocondrial é permissiva na formação de poros na membrana mitocondrial externa gerada por Bax / Bak durante a apoptose [11]. Demonstrou-se que o Drp1 é recrutado seletivamente para as mitocôndrias durante a apoptose [11] e, de acordo com isso, mitocôndrias fragmentadas foram observadas no início do processo [27]. Por outro lado, acredita-se que a inibição da fissão mitocondrial inibe a apoptose bloqueando a formação dos poros da membrana externa que permitem a liberação do citocromo c [53]. Consequentemente, a estimulação da fusão mitocondrial retarda a progressão da apoptose induzida por compostos, incluindo estaurosporina (STS) [14]. Para determinar se o SFN protege as células RPE-1 da apoptose mediada por STS e, em caso afirmativo, se isso requer Nrf2, estabelecemos um ensaio para induzir facilmente a clivagem poli-ADP ribose polimerase (PARP), um substrato de caspase-3 e definitivo marcador de apoptose. O tratamento de células RPE-1 com 1 µM ​​STS para 6 h apenas causou uma clivagem muito modesta da PARP, no entanto, isto foi evitado pelo co-tratamento com SFN (por exemplo, Fig. 4A, pista 3 versus 4). Para aumentar a robustez deste ensaio, sensibilizámos ainda mais as células para a apoptose induzida por STS, pré-tratando-as com siRNA dirigido ao factor anti-apoptótico, Bcl-XL. Este pré-tratamento reduziu a expressão de Bcl-XL e a clivagem marcadamente promovida da PARP em função do tempo exposto ao STS (Fig. 4B, comparar a linha 2 às pistas 4-10). Importante, 2 h de pré-tratamento com SFN mitigou a clivagem de PARP em células expostas a STS (Fig. 4C, pista 3 versus 4 e pista 5 versus 6). Do mesmo modo, as células estavelmente esgotadas de Nrf2 por CRISPR / Cas9 foram comparativamente protegidas da toxicidade de STS pelo pré-tratamento com SFN (Fig. 4C, pista 11 versus 12 e pista 13 versus 14 e Fig. 4D). Esta protecção foi observada utilizando tanto a clivagem de PARP (Fig. 4C e D) como a morfologia celular (Fig. 4E) como leituras. A eficácia da depleção de Nrf2 por CRISPR / Cas9 foi confirmada por Western blotting (Fig. 4C, Nrf2 blot). Como previsto, as células depletadas de Drp1, que também produzem um fenótipo de hiperfusão (Fig. 1A), também bloquearam a clivagem de PARP em resposta a STS em comparação com células de controlo incubadas com SFN (Fig. 4F e G). Juntos, esses achados são consistentes com o SFN conferindo proteção contra a apoptose através de sua capacidade de restringir a função Drp1, independente da estabilização e ativação do Nrf2.

Figura 4 Os efeitos citoprotectores do SFN são independentes da expressão Nrf2 (A) As células RPE-1 foram pré-tratadas com DMSO ou 50 μM SFN para 2 h antes do tratamento com DMSO, XSAUMX μM estaurosporina (STS) ou 1 μM etoposido 50 he foram processados ​​para western blotting anti-PARP. (B) As células RPE-1 foram transfectadas com 2.5 nM siCON, 1 nM siBcl-XL ou 2.5 nM siBcl-XL e 3 dias depois foram tratadas com DMSO ou 1 μM STS para 2, 4 ou 6 h. Western blots representativos são mostrados e a migração de marcadores de peso molecular é indicada à esquerda. (C) Células RPE-9 geradas por CRISPR / Cas2 (Nrf2WT) e Nrf2 (Nrf1KO) foram transfectadas com 1 nM siBcl-XL e 3 dias mais tarde foram pré-tratadas com DMSO ou 50 μM SFN para 2 h. Posteriormente, as células foram tratadas com 1 μM STS para 2, 4 ou 6 h. Western blots representativos com os anticorpos indicados são mostrados. (D) Quantificação da PARP clivada como uma percentagem da PARP total (clivada + não clivada) das experiências independentes da 3. Importante, os níveis de PARP clivada foram comparáveis ​​se as células expressaram Nrf2 ou não, indicando que a proteção SFN do STS é independente do fator de transcrição. Imagens de contraste de fase (E) 20X tiradas imediatamente antes da colheita de lisados ​​de (C). Barra de escala = 65 µm. (F) Western blots representativos demonstrando que a depleção de Drp1 confere proteção quase comparável da STS como tratamento com SFN. As células RPE-1 foram transfectadas com 1 nM siBcl-XL e adicionalmente transfectadas com 10 nM siCON ou 10 nM siDrp1. 3 dias depois, as células siCON foram pré-tratadas com SFN como em (A) e (C) e depois expostas a STS para 4 h antes de serem colhidas e processadas para western blotting com os anticorpos indicados. (G) O mesmo que (D) para os dados apresentados em (F) compilados a partir de experiências independentes com 3. Barras de erro refletem +/- SEM

Discussão

Descobrimos que o SFN modula a dinâmica de fissão / fusão mitocondrial independente de seus efeitos na via KEAP1-Nrf2-ARE. Isso é intrigante por causa de uma suposta ligação entre a disfunção mitocondrial e a produção de ROS e a necessidade de eliminar radicais livres derivados de mitocôndrias através da ativação de Nrf2. Este impacto funcional adicional da SFN é de importância potencial, dados os mais de 30 ensaios clínicos em andamento testando SFN para o tratamento de uma variedade de doenças, incluindo câncer de próstata, doença pulmonar obstrutiva e doença falciforme [7], [10], [ 47].

Como o SFN é um isotiocianato [56] e ativa a sinalização Nrf2 pela acilação direta de cisteínas KEAP1 críticas para suprimir a degradação Nrf2 [21], segue-se que o SFN exerce seus efeitos pró-fusão modulando a atividade de um fator de fissão ou fusão via modificação de cisteína . Nossos dados apoiam fortemente que o Drp1 seja regulado negativamente pelo SFN, embora a GTPase seja um alvo direto de acilação permanece por esclarecer. Apesar dessa lacuna de conhecimento, a função do Drp1 está claramente sendo comprometida pelo SFN, já que tanto as mitocôndrias quanto os peroxissomos se tornam hiperfusado em resposta ao tratamento com SFN e estas organelas compartilham Drp1 para seus respectivos eventos de cisão [38]. Além disso, o SFN diminui a quantidade de Drp1 que se localiza e se acumula na mitocôndria (Fig. 3). Como nossos experimentos foram feitos com todas as proteínas endógenas, nossa detecção de Drp1 em locais de fissão mitocondrial está sob condições de estado estacionário e, conseqüentemente, não podemos distinguir entre um recrutamento versus um defeito de retenção da enzima causada pelo SFN. Além disso, não podemos eliminar a possibilidade de o SFN acilar um receptor nas mitocôndrias (Fis1 ou Mff) para bloquear o recrutamento de Drp1, no entanto, suspeitamos que o Drp1 seja diretamente modificado. O Drp1 possui nove cisteínas, oito das quais residem no Domínio Médio que é necessário para a oligomerização [3], e uma delas reside no GED (GTPase Effector Domain - GED) no C-terminal de Drp1. A acilação direta de qualquer uma dessas cisteínas poderia causar um defeito de atividade no Drp1 e, portanto, fundamentar o efeito do SFN na dinâmica mitocondrial. Notavelmente, trabalhos anteriores sugerem que defeitos na oligomerização e atividade catalítica podem anular a retenção de Drp1 nas mitocôndrias [52]. Cys644 no domínio GED é um alvo particularmente atraente baseado em trabalhos anteriores mostrando que a mutação dessa fenotopia cisteína mutações que prejudicam a atividade Drp1 GTPase [4] e que esta cisteína particular é modificada por eletrófilos reativos ao tiol [9]. A resolução desta questão pendente exigirá validação espectrométrica de massa.Dentro Em resumo, identificamos uma nova função citoprotetora para o SFN composto clinicamente relevante. Além de ativar o fator de transcrição mestra anti-oxidante Nrf2, o SFN promove a fusão mitocondrial e peroxisomal, e este efeito é independente do Nrf2. O mecanismo subjacente a esse fenômeno envolve uma redução na função do GTPase Drp1, o principal mediador da fissão mitocondrial e peroxisomal. Uma das principais conseqüências da fusão mitocondrial mediada pelo SFN é que as células se tornam resistentes aos efeitos tóxicos da estaurosporina indutora da apoptose. Essa ação citoprotetora adicional da SFN poderia ser de utilidade clínica particular nas numerosas doenças neurodegenerativas para as quais a idade é o principal fator de risco (por exemplo, Doença de Parkinson, Doença de Alzheimer, Degeneração Macular Relacionada à Idade), pois essas doenças têm sido associadas à apoptose níveis e / ou desregulação de Nrf2 [35], [36], [48]. Juntos, esses dados demonstram que as propriedades citoprotetoras do SFN se estendem além da ativação do sistema KEAP1-Nrf2-ARE e justificam novos estudos, dado o uso atual deste agente em múltiplos ensaios clínicos..

Materiais e Mmétodos

Ensaios de Apoptose

As células foram semeadas e transfectadas com siRNA como indicado abaixo. As células foram pré-tratadas com 50 μM sulforafano para 2 h para induzir a fusão mitocondrial e foram então tratadas com estaurosporina 1 μM para induzir a apoptose. No momento da colheita, os meios foram recolhidos em tubos individuais e submetidos a centrifugação a alta velocidade para sedimentar as células apoptóticas. Este sedimento celular foi combinado com células aderentes e solubilizado em tampão Laemmli concentrado 2 vezes. As amostras foram submetidas a western blotting anti-PARP.

Geração de Construções CRISPR / Cas9

Para criar o LentiCRISPR / eCas9 1.1, o LentiCRISPR v2 (addgene #52961) foi primeiro cortado com Age1 e BamH1. Em seguida, SpCas9 de eSpCas9 1.1 (addgene #71814) foi amplificado por PCR com prolongamentos Age1 e BamH1 usando os seguintes primers (Forward AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) e ligado no vector de corte acima. As sequências de sgRNA foram determinadas usando Benchling.com. Os parâmetros foram definidos para direcionar a sequência de codificação com os maiores pontuações no alvo e mais baixos fora do alvo. As seguintes sequências (sequência de direccionamento sublinhadas, hs sgNFE2L2 # 1 sentido CACCGCGACGGAAAGAGTATGAGC, anti-sentido AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2 # 2 sentido CACCGGTTTCTGACTGGATGTGCT, AAACAGCACATCCAGTCAGAAACC anti-sentido; hs sgNFE2L2 # 3 sentido CACCGGAGTAGTTGGCAGATCCAC, anti-sentido AAACGTGGATCTGCCAACTACTCC) foram emparelhados e ligados em BsmB1 cortar LentiCRISPR / eCas9 1.1. Células RPE-1 infectadas por lentivírus foram selecionadas com puromicina e mantidas como uma população agrupada. Knockout foi confirmado por imunofluorescência e western blotting.

Cultura de células e transfecções

As células epiteliais pigmentares da retina humana transformadas com telomerase (RPE-1) (ATCC) foram cultivadas em meio de Eagle modificado por Dulbecco (DMEM) contendo 1 g / L glucose suplementada com penicilina, estreptomicina, 1X cocktail de aminoácidos não essenciais (Life Technologies), e 10% de Soro Bovino Fetal (Life Technologies). Para transfecções de siRNA, as células 30,000-35,000 / mL foram semeadas durante a noite. As células receberam ARNsi 10 nM diluído em DMEM isento de soro e combinado com o reagente de transfecção Interferina 0.3% (PolyPlus). Para a sensibilização da apoptose, as células receberam o siRNA BNLX-1 nM. As células foram colhidas 2-3 dias pós-transfecção.

Produtos Químicos, Anticorpos e siRNA Oligos

Anticorpos contra α-tubulina (Sinalização Celular), β-tubulina (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamina B1 (Abcam), PARP (Sinalização Celular), PMP70 (Abcam) e Tom20 (BD Biosciences ) foram utilizados em diluições 1: 1000 para western blotting e para imunofluorescência. O anticorpo interno de coelho anti-Nrf2 foi utilizado em 1: 2000 para western blotting [34], [59]. Sulforafano (Sigma) e estaurosporina (Tocris) foram utilizados em 50 μM e 1 μM, respectivamente. Os ARNsi contra Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Sinaliza�o Celular) e Bcl-XL (Sinaliza�o Celular) foram utilizados a 10 nM, salvo indica�o em contr�io.

Imunofluorescência e Rotulagem in Vivo

As células semeadas em lamelas de vidro 18 mm foram tratadas com veículo ou fármaco, fixadas em 3.7% formaldeído e depois permeabilizadas em 0.2% Triton X-100 / PBS em gelo durante 10 min. Os anticorpos primários foram incubados em 3% de albumina de soro bovino (BSA) em PBS durante a noite a 4 ° C. Após lavagens com PBS, as células foram incubadas para 1 h em anticorpos secundários conjugados com as espécies Alexa488 ou Alexa546 apropriados (1: 1000 diluído) e 0.1 μg / mL DAPI (Sigma) em 3% BSA / PBS. As mitocôndrias foram visualizadas por imunofluorescência anti-Tom20 ou por incubação de células em 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) em DMEM isento de soro para 30 min a 37 ° C antes da fixação.

Microscopia e Análise de Imagem

As amostras de imunofluorescência foram visualizadas num microscópio LSM710 Confocal (Carl Zeiss). Micrografias foram capturadas usando objetivas de imersão em óleo 63X ou 100X e imagens ajustadas e aprimoradas usando o Adobe Photoshop CS6. A análise de co-localização foi realizada usando o recurso de co-localização Carl Zeiss LSM710 com limites definidos manualmente, mas sem a identidade das amostras. Barras de escala, salvo indicação em contrário, são 10 µm. A morfologia mitocondrial foi avaliada por pontuação cega. Se as mitocôndrias de uma célula fossem mantidas como puncta múltipla, redonda e discriminada, a célula era pontuada como 'fissão'. Se as mitocôndrias individuais fossem indistinguíveis e toda a rede mitocondrial parecesse contínua, a célula era classificada como "fusão". Todas as outras células, incluindo aquelas com mitocôndrias em cluster, foram classificadas como 'intermediárias'.

Fraccionamentos Subcelulares

As células RPE-1 foram cultivadas até à confluência. Após lavagem PBS, as células foram submetidas a centrifugação a 600 × g durante 10 min e ressuspensas em tampão de isolamento 600 μL (210 mM Manitol, 70 mM Sacarose, 5 mM MOPS, 1 mM EDTA pH 7.4 + 1 mM PMSF). A suspens foi lisada vezes 30 num homogeneizador Dounce. Uma fração do homogeneizado foi preservada como um “lisado de célula inteira”. O restante foi submetido a centrifugação a 800 × g por 10 min para sedimentar os núcleos. Os sobrenadantes foram submetidos a centrifugação a 1500 × g durante 10 min para limpar os núcleos remanescentes e as células não lisadas. Este sobrenadante foi submetido a centrifugação a 15,000 × g durante 15 min para sedimentar as mitocôndrias. O sobrenadante foi preservado como a “fração citosólica”. O sedimento foi lavado suavemente com PBS e ressuspenso em tampão de isolamento. A concentrao de protea de cada fraco foi medida atrav do ensaio do ido bicinchonico (BCA) e quantidades equivalentes de protea foram resolvidas por SDS-PAGE.

Western blotting

As c�ulas foram lavadas em PBS e solubilizadas em tamp� solubilizante Laemmli concentrado 2 vezes (100 mM Tris [pH 6.8], 2% SDS, 0.008% de azul de bromofenol, 2% 2-mercaptoetanol, 26.3% de glicerol e 0.001% Pirinina Y) Os lisados ​​foram fervidos durante 5 min antes do carregamento em géis de poliacrilamida com dodecilsulfato de sódio (SDS). As proteínas foram transferidas para membranas de nitrocelulose e as membranas foram bloqueadas para 1 h em 5% Milk / TBST. Os anticorpos primários foram diluídos em 5% Milk / TBST e incubados com o blot durante a noite a 4 ° C. Os anticorpos secundários conjugados com peroxidase de rábano (HRP) foram diluídos em 5% Milk / TBST. Os blots foram processados ​​com quimiluminescência aprimorada e quantificações densitométricas foram realizadas usando o software ImageJ.

Dr Jimenez White Coat

Sulforafano é um produto químico da coleção isotiocianato de substâncias organossulfúricas obtidas a partir de vegetais crucíferos, incluindo brócolis, repolho, couve-flor, couve e couve, entre outros. O sulforafano é produzido quando a enzima mirosinase transforma a glucorafanina, um glucosinolato, em sulforafano, também conhecido como sulforafano-glicosinolato. Brotos de couve-flor e couve-flor têm a maior concentração de glucorafanina ou o precursor do sulforafano. Estudos de pesquisa demonstraram que o sulforafano aumenta a capacidade antioxidante do corpo humano para prevenir vários problemas de saúde.

Dr. Alex Jimenez DC, Insight CCST

Sulforafano e seus efeitos no câncer, mortalidade, envelhecimento, cérebro e comportamento, doença cardíaca e mais

Os isotiocianatos são alguns dos compostos vegetais mais importantes que você pode obter em sua dieta. Nisso vídeo Eu faço o caso mais abrangente para eles que já foi feito. Curto período de atenção? Pule para o seu tópico favorito clicando em um dos pontos de tempo abaixo. completo cronograma abaixo.

Seções principais:

  • 00: 01: 14 - Câncer e mortalidade
  • 00: 19: 04 - envelhecimento
  • 00: 26: 30 - Cérebro e comportamento
  • 00: 38: 06 - recapitulação final
  • 00: 40: 27 - dose

Cronograma completo:

  • 00: 00: 34 - Introdução do sulforafano, um dos principais focos do vídeo.
  • 00: 01: 14 - Consumo de vegetais crucíferos e reduções na mortalidade por todas as causas.
  • 00: 02: 12 - risco de câncer de próstata.
  • 00: 02: 23 - risco de câncer de bexiga.
  • 00: 02: 34 - Câncer de pulmão em risco de fumantes.
  • 00: 02: 48 - risco de câncer de mama.
  • 00: 03: 13 - Hipotético: e se você já tem câncer? (intervencionista)
  • 00: 03: 35 - condução de mecanismo plausível o cancer e dados associativos de mortalidade.
  • 00: 04: 38 - Sulforafano e câncer.
  • 00: 05: 32 - evidência animal mostrando mais forte, Efeito do extrato de brócolis no desenvolvimento do tumor de bexiga em ratos.
  • 00: 06: 06 - Efeito da suplementação direta de sulforafano em pacientes com câncer de próstata.
  • 00: 07: 09 - Bioacumulação de metabólitos de isotiocianato no tecido mamário atual.
  • 00: 08: 32 - Inibição de células estaminais de cancro da mama.
  • 00: 08: 53 - Lição de História: os brassicas foram estabelecidos como tendo propriedades de saúde mesmo na Roma antiga.
  • 00: 09: 16 - A capacidade do Sulforaphane de aumentar a excreção de carcinógeno (benzeno, acroleína).
  • 00: 09: 51 - NRF2 como um interruptor genético através de elementos de resposta antioxidante.
  • 00: 10: 10 - Como a ativação de NRF2 aumenta a excreção de carcinógenos via conjugados de glutationa-S.
  • 00: 10: 34 - As couves-de-bruxelas aumentam a glutationa-S-transferase e reduzem os danos no DNA.
  • 00: 11: 20 - Bebida de brócolis aumenta a excreção de benzeno em 61%.
  • 00: 13: 31 - O homogenato de brócolis aumenta as enzimas antioxidantes nas vias aéreas superiores.
  • 00: 15: 45 - Consumo de vegetais crucíferos e mortalidade por doenças cardíacas.
  • 00: 16: 55 - Brócolis em pó melhora os lipídios no sangue e o risco geral de doenças cardíacas em diabéticos tipo 2.
  • 00: 19: 04 - início de envelhecimento seção.
  • 00: 19: 21 - dieta enriquecida com sulforafano aumenta tempo de vida de besouros de 15 para 30% (em certas condições).
  • 00: 20: 34 - Importância da baixa inflamação para a longevidade.
  • 00: 22: 05 - Os vegetais crucíferos e o pó de brócolis parecem reduzir uma grande variedade de marcadores inflamatórios em humanos.
  • 00: 23: 40 - Recapitulação de vídeo intermediário: câncer, seções de envelhecimento
  • 00: 24: 14 - Estudos com ratos sugerem que o sulforafano pode melhorar a função imunológica adaptativa na velhice.
  • 00: 25: 18 - Sulforaphane melhorou o crescimento do cabelo em um modelo de rato de calvície. Imagem em 00: 26: 10.
  • 00: 26: 30 - Início da seção do cérebro e comportamento.
  • 00: 27: 18 - Efeito do extrato de brócolis no autismo.
  • 00: 27: 48 - Efeito da glucorafanina na esquizofrenia.
  • 00: 28: 17 - Início da discussão sobre depressão (mecanismo plausível e estudos).
  • 00: 31: estudo 21 - Mouse usando modelos 10 diferentes de depressão induzida por estresse mostram sulforafano igualmente eficaz como fluoxetina (prozac).
  • 00: 32: 00 - Estudo mostra a ingestão direta de glucorafanina em camundongos é igualmente eficaz na prevenção da depressão do modelo de estresse de derrota social.
  • 00: 33: 01 - Início da seção de neurodegeneração.
  • 00: 33: 30 - Sulforafano e doença de Alzheimer.
  • 00: 33: 44 - Sulforaphane e doença de Parkinson.
  • 00: 33: 51 - Sulforaphane e doença de Hungtington.
  • 00: 34: 13 - Sulforafano aumenta as proteínas de choque térmico.
  • 00: 34: 43 - Início da seção de traumatismo cranioencefálico.
  • 00: 35: 01 - Sulforafano injetado imediatamente após o TBI melhora a memória (estudo do mouse).
  • 00: 35: 55 - Sulforafano e plasticidade neuronal.
  • 00: 36: 32 - Sulforaphane melhora a aprendizagem em modelo de diabetes tipo II em camundongos.
  • 00: 37: 19 - sulforafano e Duchenne distrofia muscular.
  • 00: 37: 44 - Inibição da miostatina em células satélites musculares (in vitro).
  • 00: 38: 06 - Recapitulação de vídeo tardio: mortalidade e câncer, danos no DNA, estresse oxidativo e inflamação, excreção de benzeno, doença cardiovascular, diabetes tipo II, efeitos no cérebro (depressão, autismo, esquizofrenia, neurodegeneração), via NRF2.
  • 00: 40: 27 - Pensamentos em descobrir uma dose de brotos de brócolis ou sulforafano.
  • 00: 41: 01 - Anedotas sobre brotar em casa.
  • 00: 43: 14 - Nas temperaturas de cozimento e atividade de sulforafano.
  • 00: 43: 45 - Conversão da bactéria intestinal do sulforafano da glucorafanina.
  • 00: 44: 24 - Os suplementos funcionam melhor quando combinados com a mirosinase ativa de vegetais.
  • 00: 44: 56 - Técnicas de cozinha e vegetais crucíferos.
  • 00: 46: 06 - Isotiocianatos como sendo goitrogénios.

Agradecimentos

Sciencedirect.com/science/article/pii/S2213231716302750

Como o sulforafano é produzido?

O aquecimento diminui a atividade da proteína epithiospecifier e aumenta a formação de sulforafano em brócolis

Abstrato

Sulforafano, um isotiocianato de brócolis, é um dos anticarcinógenos derivados de alimentos mais potentes. Este composto não está presente no vegetal intacto, antes é formado a partir do seu precursor glucosinolato, a glucorafanina, pela ação da mirosinase, uma enzima tioglucosidase, quando o tecido de brócolis é esmagado ou mastigado. No entanto, vários estudos demonstraram que o rendimento de sulforafano a partir da glucorafanina é baixo, e que um análogo de nitrilo não bioativo, sulforafano nitrilo, é o principal produto de hidrólise quando o tecido da planta é esmagado à temperatura ambiente. Evidências recentes sugerem que, em Arabidopsis, a formação de nitrila a partir de glucosinolatos é controlada por uma proteína sensível ao calor, epithiospecifier proteína (ESP), um cofactor não catalítico da mirosinase. Nossos objetivos foram examinar os efeitos do aquecimento de brotos de brócolis e brotos na formação de sulforafano e sulforafano nitrilo, para determinar se o brócolis contém atividade de ESP, e correlacionar mudanças dependentes do calor na atividade de ESP, teor de sulforafano e bioatividade, medidos pela indução do enzima de desintoxicação de fase II quinona redutase (QR) em cultura de células. O aquecimento de brotos de brócolis frescos ou brotos de brócolis a 60 ° C antes da homogeneização aumentou simultaneamente a formação de sulforafano e diminuiu a formação de nitrilo de sulforafano. Uma perda significativa da atividade de ESP ocorreu em paralelo à diminuição na formação de nitrilo de sulforafano. O aquecimento a 70 ° C e acima diminuiu a formação de ambos os produtos em brócolis, mas não em brotos de brócolis. A indução de QR em células Hepa lclc7 de hepatoma de murganho cultivadas em paralelo aumenta na formação de sulforafano.

Pré-aquecer florzinhas de brócolis e brotos a 60 ° C aumentaram significativamente a formação de sulforafano (SF) catalisada por mirosinase em extratos de tecido vegetal após o esmagamento. Isto foi associado com diminuições na formação do sulforafano nitrilo (SF Nitrile) e da atividade da proteína epithiospecifier (ESP).

Palavras-chave: Brócolis, Brassica oleracea, Crucíferas, Câncer, Anticarcinogênio, Sulforafano, Sulforafane nitrilo, Proteína epithiospecifier, Quinona redutase

Em conclusão, o sulforafano é um fitoquímico encontrado em brócolis,e outros vegetais crucíferos. Uma quantidade descontrolada de oxidantes causada por fatores internos e externos pode causar estresse oxidativo no corpo humano, o que pode levar a uma variedade de problemas de saúde. O sulforafano pode ativar a produção do Nrf2, um fator de transcrição que ajuda a regular os mecanismos antioxidantes protetores que controlam a resposta da célula aos oxidantes. O escopo de nossas informações é limitado a questões quiropráticas e de saúde da coluna vertebral. Para discutir o assunto, sinta-se à vontade para perguntar ao Dr. Jimenez ou entrar em contato conosco 915-850-0900 .

Curated pelo Dr. Alex Jimenez

Referenciado de: Sciencedirect.com

Chamada Verde Agora Botão H .png

Discussão Adicional do Tópico: Dor Lombar Aguda

Dor nas costas é uma das causas mais prevalentes de incapacidade e perdeu dias de trabalho em todo o mundo. A dor nas costas atribui-se à segunda razão mais comum para visitas a consultórios, superada apenas por infecções respiratórias superiores. Aproximadamente 80 por cento da população experimentará dor nas costas pelo menos uma vez ao longo da vida. A coluna é uma estrutura complexa composta de ossos, articulações, ligamentos e músculos, entre outros tecidos moles. Por causa disso, lesões e / ou condições agravadas, como hérnia de discos, pode eventualmente levar a sintomas de dor nas costas. Lesões esportivas ou acidentes automobilísticos geralmente são a causa mais frequente de dor nas costas, no entanto, às vezes, o mais simples dos movimentos pode ter resultados dolorosos. Felizmente, opções alternativas de tratamento, como quiropraxia, podem ajudar a aliviar a dor nas costas através do uso de ajustes espinhais e manipulações manuais, melhorando o alívio da dor.

Foto do blog do papel de desenho animado

EXTRA EXTRA | TÓPICO IMPORTANTE: Recomendado Chiropractor El Paso, TX

***